94
|
ATCC
c difficile atcc 9689d C Difficile Atcc 9689d, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c+curvus+atcc/Clostridioides+difficile%3B+90556-M6S%3B+genomic+DNA/pm40696806-38-15-17 Average 94 stars, based on 1 article reviews
c difficile atcc 9689d - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
96
|
ATCC
caption a7 Caption A7, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c+curvus+atcc/A7/pmc02075075-337-50-63 Average 96 stars, based on 1 article reviews
caption a7 - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
99
|
ATCC
c circle positive control standard curve dna C Circle Positive Control Standard Curve Dna, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c+curvus+atcc/U-2+OS/10__21769_slash_bioprotoc__4627-57-6-13 Average 99 stars, based on 1 article reviews
c circle positive control standard curve dna - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
90
|
ATCC
wild type c cohnii strain atcc mk8805 Wild Type C Cohnii Strain Atcc Mk8805, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c+curvus+atcc/Crypthecodinium+Cohnii%3B+Mk8805/10__1128_slash_ec__00461___07-193-7-11 Average 90 stars, based on 1 article reviews
wild type c cohnii strain atcc mk8805 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
91
|
ATCC
c curvus atcc 35224 C Curvus Atcc 35224, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c+curvus+atcc/Campylobacter+curvus/pmc02293133-60-61-63 Average 91 stars, based on 1 article reviews
c curvus atcc 35224 - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
95
|
ATCC
positive control specimen Positive Control Specimen, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c+curvus+atcc/Campylobacter+jejuni+subsp%2E+jejuni+(Jones+et+al%2E)+Steele+and+Owen/10__1128_slash_jcm__00896___07-100-20-25 Average 95 stars, based on 1 article reviews
positive control specimen - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
95
|
ATCC
atcca 33237 agacaagaatttgcaaaaggtatccctcaa aatcgcttgaaaagatctttgtcttccttg c curvus seq id Atcca 33237 Agacaagaatttgcaaaaggtatccctcaa Aatcgcttgaaaagatctttgtcttccttg C Curvus Seq Id, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c+curvus+atcc/Campylobacter+concisus+Tanner+et+al/us08574843-340-46-60 Average 95 stars, based on 1 article reviews
atcca 33237 agacaagaatttgcaaaaggtatccctcaa aatcgcttgaaaagatctttgtcttccttg c curvus seq id - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
92
|
ATCC
c curvus 525 92 C Curvus 525 92, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c+curvus+atcc/Neoscytalidium+dimidiatum+(Penzig)+Crous+et+Slippers/pm28629508-109-49-55 Average 92 stars, based on 1 article reviews
c curvus 525 92 - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
95
|
ATCC
33237 cp012541 c curvus 33237 Cp012541 C Curvus, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c+curvus+atcc/Campylobacter+concisus/pmc06321876__mgen___4___228___s001-7-35-34 Average 95 stars, based on 1 article reviews
33237 cp012541 c curvus - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
99
|
ATCC
c albicans C Albicans, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c+curvus+atcc/Candida+albicans+(Robin)+Berkhout/pmc06958376-99-32-34 Average 99 stars, based on 1 article reviews
c albicans - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
97
|
ATCC
c concisus cp000792 c curvis c curvis cp000767 c fetus C Concisus Cp000792 C Curvis C Curvis Cp000767 C Fetus, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c+curvus+atcc/M-1/pmc03569610__emi0013___1549___sd3-1-9-6 Average 97 stars, based on 1 article reviews
c concisus cp000792 c curvis c curvis cp000767 c fetus - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
90
|
Ribobio co
siaeg-1 sense Siaeg 1 Sense, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c+curvus+atcc/fluorescein+tagged+sirna+siaeg+1/10__2147_slash_ijn__s147747-51-4-27 Average 90 stars, based on 1 article reviews
siaeg-1 sense - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |